MiRNA AAAannotations

From GO Wiki
Jump to: navigation, search

back to the agenda page

back to the miRNA page

Inhibition of microRNA-29b reduces murine abdominal aortic aneurysm development, PMID:22269326

Figure 1 Murine model of experimental AAA: the porcine pancreatic elastase (PPE) infusion model in C57BL/6 mice Annotation 1: possibly porcine elastase GO:0030198 extracellular matrix organization IDA >But I think this model is quite artificial I don’t feel comfortable annotating any of this data.

Figure 2 Murine model of experimental AAA: AngII infusion model in Apoe–/– mice. >I think this model is quite artificial I don’t feel comfortable annotating any of this data.

In these 2 models the induction of AAA is associated with: Decreased aortic expression of miR-29b Increased expression of known miR-29b targets, Col1a1, Col3a1, Col5a1 and Eln > the above is not annotatable, these 2 figures alone do not provide evidence that miR-29b regulates these genes. There may be other miRs or transcription factors being disregulated, with similar targets to those of miR-29b. > Also I wouldn’t create annotations for elastase or AngII to capture the change in the expression of these specific genes.

Figure 3 Cell culture studies identified aortic fibroblasts as the likely vascular cell type mediating the profibrotic effects of miR-29b modulation. These studies use primary human cells, cultured invitro, and are not growth arrested. Author confirmed that soluble collagen is a measure of profibrosis. Human aortic smooth muscle cells (hASMCs) human aortic adventitial fibroblasts (hAFBs)

Figure 3A Cells were treated with human TGF-β1, a known regulator of miR-29b, and profibrotic stimulus. Treatment with TGF-β1 significantly decreased miR-29b expression in hAFBs but not in hASMCs. Annotation 2: Human TGF-β1 GO:2000628 regulation of miRNA metabolic process IDA C16: has_regulation_target human miR-29b, occurs_in CL:0002547 fibroblast of the aortic adventitia >should cell type be included here.

Note that the evidence is that there is more miR following TGF-β1 treatment. Potentially this could be regulation of catabolism, however the majority of equivalent mRNA experiments have been annotated as GO:0000122 negative regulation of transcription from RNA polymerase II promoter.

So should this be captured instead as GO:2000629 negative regulation of miRNA metabolic process or should there be a negative regulation of miRNA biosynthetic process?

Figure 3B-D In all of these figures miR-29b expression was then modified by transfecting with either an antagomir (anti-29b) to inhibit activity or a pre-miR (pre-29b) to enhance activity in both cell lines. Or scrambled miR (control) Scr-miR

Figure 3B Expression levels of miR-29b target genes (COL1A1, COL3A1, ELN, FBN1) in Tgf-β–stimulated anti-29b– and pre-29b–transfected hAFBs were measured (compared to levels in cells not stimulated with Tgf-β). COL1A1 and COL3A1 were significantly up regulated with Tgf-β-stimulation, and further up-regulated with anti-29b treatment and significantly down regulated with pre-29b. From methods the expression is measured by qRT-PCR. Therefore level of mRNA measured.

Annotation 3: Human TGF-β1 GO:0010628 positive regulation of gene expression IDA C16: has_regulation_target human COL1A1 and COL3A1, occurs_in CL:0002547 fibroblast of the aortic adventitia

Annotation 4 (in combination with Fig 3A): Human TGF-β1 GO:0070920 regulation of production of small RNA involved in gene silencing by RNA IGI WITH C8 Human miR-29b C16: has_ regulation_target human COL1A1 and COL3A1 occurs_in CL:0002547 fibroblast of the aortic adventitia Ideally there should be a more specific GO term: ‘negative regulation of production of small RNA involved in gene silencing by RNA’ with the parent ‘GO:0010628 positive regulation of gene expression’.

Annotation 5: Human TGF-β1: GO:0071560 cellular response to transforming growth factor beta stimulus (could also be created based on Fig 3A) occurs_in CL:0002547 fibroblast of the aortic adventitia

Annotation 6: Human miR-29b: GO:0035195 gene silencing by miRNA IMP C16: has_ regulation_target human COL1A1 [and COL3A1] occurs_in CL:0002547 fibroblast of the aortic adventitia, happens_during GO:0071560 cellular response to transforming growth factor beta stimulus.

Should there be a GO term specific for the miRNAs? Eg ‘miRNA activity involved in gene silencing’ with parent terms: has_part GO:0003729 mRNA binding part_of GO:0035195 gene silencing by miRNA is_a molecular_function Definition: Interacting selectively and non-covalently with an RNA sequence in order to modulate translation. Would there have to be evidence that this miRNA bound to the target mRNA? Note that proteins are annotated to the term GO:0035195 gene silencing by miRNA

Annotation 7: Human miR-29b: GO:0071560 cellular response to transforming growth factor beta stimulus (or new term negative regulation of this term) IMP C16 dependent_on (or in_presence_of?) Human TGF-β1 occurs_in CL:0002547 fibroblast of the aortic adventitia

Annotations 8 and 9: The addition of pre-29b could be annotated as IDA, applying the annotations listed above as 6&7, if the anti-29b experiments were not available. I would include the targets regulated (in C16) but I would not want to add information in C16 to specify the cell type based on this experiment alone.

Annotations 8: Human miR-29b: GO:0035195 gene silencing by miRNA IDA C16: has_ regulation_target human COL1A1 [and COL3A1] happens_during GO:0071560 cellular response to transforming growth factor beta stimulus. >how much of this C16 information should be included?

Annotations 9: Human miR-29b: GO:0071560 cellular response to transforming growth factor beta stimulus (or new term negative regulation of this term) IDA IMP C16 dependent_on (or in_presence_of?) Human TGF-β1

Figure 3C Expression levels of miR-29b target genes (COL1A1, COL3A1, ELN, FBN1) in Tgf-β–stimulated anti-29b– and pre-29b–transfected hASMCs (compared to levels in cells not stimulated with Tgf-β). COL1A1, COL3A1 and ELN significantly up regulated with Tgf-β–stimulation and further up-regulated with anti-29b treatment and significantly down regulated with pre-29b. From methods the expression is measured by qRT-PCR. Therefore level of mRNA measured. Annotations 10-14 Annotations the same as for Figure 3Bs (annotations 3-9) but with the C16 information: has_regulation_target human COL1A1, COL3A1, ELN occurs_in CL:0002539 aortic smooth muscle cells (hASMCs)

Figure 3D Soluble collagen assay to quantify collagen synthesis in Tgf-β–stimulated anti-29b- and pre-29b-transfected hAFBs.

Annotation 15 Human TGF-β1 GO:0032967 positive regulation of collagen biosynthetic process IDA, C16, occurs_in CL:0002547 fibroblast of the aortic adventitia

Annotation 16 same as Annotation 7: Human miR-29b: GO:0071560 cellular response to transforming growth factor beta stimulus (or new term negative regulation of this term) IMP C16 dependent_on (or in_presence_of?) Human TGF-β1 occurs_in CL:0002547 fibroblast of the aortic adventitia

Annotation 17 Human miR-29b GO:0032966 negative regulation of collagen biosynthetic process IMP C16: occurs_in CL:0002547 fibroblast of the aortic adventitia happens_during GO:0071560 cellular response to transforming growth factor beta stimulus. Again if the annotation was based on the pre-29b experiment this would have the IDA evidence code and I would not capture the cell specific information in C16.

Annotation 18 Human miR-29b GO:1901202 negative regulation of extracellular matrix assembly IC WITH GO:0032966 negative regulation of collagen biosynthetic process C16: happens_during GO:0071560 cellular response to transforming growth factor beta stimulus, occurs_in CL:0002547 fibroblast of the aortic adventitia.

Annotation 19 Human TGF-β1 GO:1901203 positive regulation of extracellular matrix assembly IC WITH GO:0032967 positive regulation of collagen biosynthetic process C16: occurs_in CL:0002547 fibroblast of the aortic adventitia

Figure 4 Murine model of experimental AAA: the porcine pancreatic elastase (PPE) infusion model in C57BL/6 mice plus in vivo administration of locked nucleic acid anti–miR-29b or pre-29b. > experimental data suggests not annotating ‘normal’ tissue response.

Figure 4A Confirms incorporation of pre-miR-29b and anti-29b into aortic wall. >no annotations

Figure 4B Addition of pre-29b increased the abdominal aortic diameter (AAD) growth Addition of anti-29b reduced AAD growth

Annotation 20 Mouse miR-29b GO:1901202 negative regulation of extracellular matrix assembly IMP or IDA (not including C16 tissue information as very artificial situation)

Figure 4C-E Anti-29b significantly increased Col1a1, Col3a1 and Eln expression (mRNA), pre-29b significantly reduced Col1a1, Col3a1 and Eln expression (mRNA),

Annotation 21 Mouse miR-29b GO:0035195 gene silencing by miRNA IMP (or IDA) C16: has_ regulation_target mouse Col1a1 [and Col3a1 and Eln]

Figure 4F In Figure 4F the expression of collagen and Eln genes in non-aneurysmal suprarenal aorta tissue is not affected by decreased or increased miR-29b expression, which is in contrast to the impact on gene expression by decreased or increased miR-29b expression, in AAA (Fig 4C-E). >no annotations

Figure 5 Fibrosis in mice with PPE-induced AAAs. Treated with pre-29b, or anti-29b

Figure 5A Illustrates fibrosis and aneurysm expansion. There is an increase in vascular fibrosis in anti-29b injected mice, and almost no fibrotic or proliferative response in pre-29b-treated (greatly dilated) aortas.

Annotation 22 Mouse miR-29b GO:1901202 negative regulation of extracellular matrix assembly IMP or IDA

Figure 5B-C Col3a1 immunohistochemistry (B) and quantification (C) An increase of Col3A1 positive cells with anti-29b treatment and a decrease of Col3A1 positive cells with pre-29b treatment.

Annotation 23 Mouse miR-29b GO:0032966 negative regulation of collagen biosynthetic process IMP or IDA C16: has_ regulation_target Col3a1

Figure 5D-F Zymography demonstrating a change in MMP (matrix metalloprotease associated with ECM degradation) activity, (D) with MMP activity lower in anti-29b treated mice compared with other 2 groups; and quantification of mRNA expression of Mmp2 (E) and Mmp9 (F) An increase of Mmp2 and Mmp9 expression with pre-29b treatment and a decrease of Mmp2 and Mmp9 expression with anti-29b treatment. >mouse miR-29b regulation of MMP activity not a direct relationship, likely to be via a more complex pathway.

Annotation 24 Mouse miR-29b GO:0090091 positive regulation of extracellular matrix disassembly IMP >is this too downstream?

Annotation 25 Mouse miR-29b GO:0010628 positive regulation of gene expression IMP or IDA C16: has_ regulation_target Mmp2 and Mmp9 >is this too downstream?

Supplemental Figure 2, A and B A similar pattern of Mmp2 and Mmp9 expression regulation was observed in TGF-β1–stimulated and miR-29b–modulated hAFBs.

Annotation 26 Human TGF-β1 GO:0010629 negative regulation of gene expression IDA C16: has_regulation_target human MMP2 and MMP9, occurs_in CL:0002547 fibroblast of the aortic adventitia

Annotation 27 Human TGF-β1 GO:0010716 negative regulation of extracellular matrix disassembly IC GO:0010629 negative regulation of gene expression C16: occurs_in CL:0002547 fibroblast of the aortic adventitia > should the cell specific information be included?

Annotation 28 Human miR-29b GO:0010628 positive regulation of gene expression IMP or IDA C16: has_ regulation_target Mmp2 and Mmp9 occurs_in CL:0002547 fibroblast of the aortic adventitia, happens_during GO:0071560 cellular response to transforming growth factor beta stimulus. >is this too downstream?

Supplemental Figure 2, C Relative miR-29b expression in anti-/pre-29b transduced mice compared to scr-miR, 14 days after injection and AAA induction using AngII. >not annotated

Supplemental Figure 2, D-F Col1a1 and Col3a1 are significantly regulated in heart (D), liver (E), and kidney (F) samples of miR-29b modulated mice. Annotation 29 Mouse miR-29b GO:0035195 gene silencing by miRNA IMP C16: has_regulation_target Col1a1 [and Col3a1] occurs_in heart, liver, kidney. >would the pre-29b data alone be annotated (as IDA) to these tissues if this was the only experimental data?

Figure 6 Effects of anti-29b and pre-29b in AngII infusion model and miR-29b regulation in human patients with AAA.

Figure 6A AAD (in percentage versus baseline) in scr-miR and anti- and pre-29b AngII-induced. > Not annotated

Figure 6B-D (B) Col1a1, (C) Col3a1, and (D) Eln expression in scr-miR– and anti- and pre-29b–transduced mice compared with that in sham-operated mice in the AngII model.

Annotation 30 Mouse miR-29b GO:0035195 gene silencing by miRNA IMP C16: has_regulation_target Col1a1 [and Col3a1 and Eln]

Annotation 31 Mouse miR-29b GO:0032966 negative regulation of collagen biosynthetic process IC WITH GO:0035195 gene silencing by miRNA

Annotation 32 Mouse miR-29b GO:1901202 negative regulation of extracellular matrix assembly IC WITH GO:0035195 gene silencing by miRNA

Figure 6E-F (E) miR-29b is the only significantly downregulated miR in human AAA samples, compared with tissue from control patients without AAA. (F) COL1A1, COL3A1, COL5A1, and ELN are significantly upregulated in human AAA tissue compared with non-aneurysmal aortic tissue. >not annotated

A similar pattern of reduced miR-29b expression and increased target gene expression was observed in human AAA tissue samples compared with that in organ donor controls.

From evidence in whole paper maybe create some IC annotations

Annotation 33 Mouse miR-29b GO:0060312 regulation of blood vessel remodeling IC WITH GO:1901202 negative regulation of extracellular matrix assembly, GO:0090091 positive regulation of extracellular matrix disassembly C16: abdominal aorta.

Annotation 34 Mouse miR-29b NEW GO term: regulation of extracellular matrix remodeling IC WITH GO:1901202 negative regulation of extracellular matrix assembly, GO:0090091 positive regulation of extracellular matrix disassembly C16: abdominal aorta

Annotation 35 Human TGF-β1 GO:0060312 regulation of blood vessel remodeling IC WITH GO:0032967 positive regulation of collagen biosynthetic process, GO:0010629 negative regulation of gene expression

Annotation 36 Human TGF-β1 NEW GO term: regulation of extracellular matrix remodeling IC WITH GO:0032967 positive regulation of collagen biosynthetic process, GO:0010629 negative regulation of gene expression

Annotation 37 Human miR-29b GO:0060312 regulation of blood vessel remodeling IC WITH GO:0032966 negative regulation of collagen biosynthetic process

Annotation 38 Human miR-29b NEW GO term: regulation of extracellular matrix remodeling IC GO:0032966 negative regulation of collagen biosynthetic process


Additional notes:

Mouse alignment identifies the sequences are on opposite strands:

Query 3 AACACTGATTTCAAATGGTGCTAGA--CAATCACTATTTAAATCTAAACCACCATATGAA 60 ||||||||||||||||||||||||| ||| | | |||||||| ||||||| |||| Sbjct 74 AACACTGATTTCAAATGGTGCTAGATACAAAGA-TGGAAAAATCTAAGCCACCATGTGAA 16 Query 61 ACCAGCTTCC 70 |||||||||| Sbjct 15 ACCAGCTTCC 6

Mouse mir29b-1>dna/mouse_build_38_nib/chr6.nib:31063022-31063093 agaacactgatttcaaatggtgctagacaatcactatttaaatctaaacc accatatgaaaccagcttcct Mouse mir29b-2>dna/mouse_build_38_nib/chr1.nib:195037039-195037120 cttctggaagctggtttcacatggtggcttagatttttccatctttgtat ctagcaccatttgaaatcagtgttttaggag >hsa-mir-29b-1 MI0000105 CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG >hsa-mir-29b-2 MI0000107 CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG

The precursor miR-29b sequence was GGTACCGTTGTCTTGGGTTTATTG. The custom-made LNA-anti-miR-29b 5′-3′ sequence was ACTGATTTCAAATGGTGCT and alignment is shown below in red, it aligns with both human sequences.

>hsa-mir-29b-1 MI0000105 CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG >hsa-mir-29b-2 MI0000107 CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG

>Would you expect both miRs to be annotated based on the anti-29b experiments and would this be IGI evidence code?

When associating 'GO:0035195 gene silencing by miRNA' with a miRNA, based on an experiment using an anti-miR to demonstrate up-regulation of specific mRNA levels in the absence of the miR, how do we decide whether or not an mRNA is a direct target of a miRNA? Eg should we take into account: predicted targets, known targets (as stated by author) or only do this if there is base-pairing to mRNA demonstrated in the paper, and/or another paper?