MiRNA AAAshort

From GO Wiki
Jump to: navigation, search

back to the agenda page

back to the miRNA page

Inhibition of microRNA-29b reduces murine abdominal aortic aneurysm development, PMID: 22269326 Note that figures from this paper are pasted at the bottom of the document

Figure 1 (Relevant to Question 1): Murine model of experimental AAA: the porcine pancreatic elastase (PPE) infusion model in C57BL/6 mice Annotation 1: possibly porcine elastase GO:0030198 extracellular matrix organization IDA >But I think this model is quite artificial I don’t feel comfortable annotating any of this data.

Figure 3 Cell culture studies identified aortic fibroblasts as the likely vascular cell type mediating the profibrotic effects of miR-29b modulation. These studies use primary human cells, cultured invitro, and are not growth arrested. Author confirmed that soluble collagen is a measure of profibrosis. Human aortic smooth muscle cells (hASMCs) human aortic adventitial fibroblasts (hAFBs)

Figure 3A (Relevant to Question 2): Cells were treated with human TGF-β1, a known regulator of miR-29b, and profibrotic stimulus. Treatment with TGF-β1 significantly decreased miR-29b expression in hAFBs but not in hASMCs. Annotation 2: Human TGF-β1 GO:2000628 regulation of miRNA metabolic process IDA C16: has_regulation_target human miR-29b, occurs_in CL:0002547 fibroblast of the aortic adventitia >should cell type be included here.

Figure 3B-D In all of these figures miR-29b expression was then modified by transfecting with either an antagomir (anti-29b) to inhibit activity or a pre-miR (pre-29b) to enhance activity in both cell lines. Or scrambled miR (control) Scr-miR

Figure 3B (Relevant to Question 3, 4, 5 & 6) Expression levels of miR-29b target genes (COL1A1, COL3A1, ELN, FBN1) in Tgf-β–stimulated anti-29b– and pre-29b–transfected hAFBs were measured (compared to levels in cells not stimulated with Tgf-β). COL1A1 and COL3A1 were significantly up regulated with Tgf-β-stimulation, and further up-regulated with anti-29b treatment and significantly down regulated with pre-29b. From methods the expression is measured by qRT-PCR. Therefore level of mRNA measured.

Annotation 6: Human miR-29b: GO:0035195 gene silencing by miRNA IMP C16: has_ regulation_target human COL1A1 [and COL3A1] occurs_in CL:0002547 fibroblast of the aortic adventitia, happens_during GO:0071560 cellular response to transforming growth factor beta stimulus.

Should there be a GO term specific for the miRNAs? Eg ‘miRNA activity involved in gene silencing’ with parent terms: has_part GO:0003729 mRNA binding part_of GO:0035195 gene silencing by miRNA is_a molecular_function Definition: Interacting selectively and non-covalently with an RNA sequence in order to modulate translation. Would there have to be evidence that this miRNA bound to the target mRNA? Note that proteins are annotated to the term GO:0035195 gene silencing by miRNA

Annotation 7: Human miR-29b: GO:0071560 cellular response to transforming growth factor beta stimulus (or new term negative regulation of this term) IMP C16 dependent_on (or in_presence_of?) Human TGF-β1 occurs_in CL:0002547 fibroblast of the aortic adventitia

Annotations 8 and 9: The addition of pre-29b could be annotated as IDA, applying the annotations listed above as 6&7, if the anti-29b experiments were not available. I would include the targets regulated (in C16) but I would not want to add information in C16 to specify the cell type based on this experiment alone.

Annotation 8: Human miR-29b: GO:0035195 gene silencing by miRNA IDA C16: has_ regulation_target human COL1A1 [and COL3A1] happens_during GO:0071560 cellular response to transforming growth factor beta stimulus. >how much of this C16 information should be included?

Annotation 9: Human miR-29b: GO:0071560 cellular response to transforming growth factor beta stimulus (or new term negative regulation of this term) IDA IMP C16 dependent_on (or in_presence_of?) Human TGF-β1

Figure 3D Soluble collagen assay to quantify collagen synthesis in Tgf-β–stimulated anti-29b- and pre-29b-transfected hAFBs.

Annotation 17 Human miR-29b GO:0032966 negative regulation of collagen biosynthetic process IMP C16: occurs_in CL:0002547 fibroblast of the aortic adventitia happens_during GO:0071560 cellular response to transforming growth factor beta stimulus.

Annotation 18 Human miR-29b GO:1901202 negative regulation of extracellular matrix assembly IC WITH GO:0032966 negative regulation of collagen biosynthetic process C16: happens_during GO:0071560 cellular response to transforming growth factor beta stimulus, occurs_in CL:0002547 fibroblast of the aortic adventitia.

Annotation 37 Human miR-29b GO:0060312 regulation of blood vessel remodeling IC WITH GO:0032966 negative regulation of collagen biosynthetic process

Annotation 38 Human miR-29b NEW GO term: regulation of extracellular matrix remodeling IC GO:0032966 negative regulation of collagen biosynthetic process

Figure 4 Murine model of experimental AAA: the porcine pancreatic elastase (PPE) infusion model in C57BL/6 mice plus in vivo administration of locked nucleic acid anti–miR-29b or pre-29b. > experimental data suggests not annotating ‘normal’ tissue response.

Figure 4B Addition of pre-29b increased the abdominal aortic diameter (AAD) growth Addition of anti-29b reduced AAD growth

Figure 4C-E Anti-29b significantly increased Col1a1, Col3a1 and Eln expression (mRNA), pre-29b significantly reduced Col1a1, Col3a1 and Eln expression (mRNA),

Annotation 20 (Figures 4B-E) Mouse miR-29b GO:1901202 negative regulation of extracellular matrix assembly IMP or IDA (not including C16 tissue information as very artificial situation)

Annotation 21 Mouse miR-29b GO:0035195 gene silencing by miRNA IMP (or IDA) C16: has_ regulation_target mouse Col1a1 [and Col3a1 and Eln]

Figure 5 Fibrosis in mice with PPE-induced AAAs. Treated with pre-29b, or anti-29b (A) Illustrates fibrosis and aneurysm expansion. There is an increase in vascular fibrosis in anti-29b injected mice, and almost no fibrotic or proliferative response in pre-29b-treated (greatly dilated) aortas.

Figure 5B-C Col3a1 immunohistochemistry (B) and quantification (C) An increase of Col3A1 positive cells with anti-29b treatment and a decrease of Col3A1 positive cells with pre-29b treatment.

Annotation 23 Mouse miR-29b GO:0032966 negative regulation of collagen biosynthetic process IMP or IDA C16: has_ regulation_target Col3a1

Figure 5D-F (Relevant to Question 7) Zymography demonstrating a change in MMP (matrix metalloprotease associated with ECM degradation) activity, (D) with MMP activity lower in anti-29b treated mice compared with other 2 groups; and quantification of mRNA expression of Mmp2 (E) and Mmp9 (F) An increase of Mmp2 and Mmp9 expression with pre-29b treatment and a decrease of Mmp2 and Mmp9 expression with anti-29b treatment. >mouse miR-29b regulation of MMP activity not a direct relationship, likely to be via a more complex pathway.

Annotation 24 Mouse miR-29b GO:0090091 positive regulation of extracellular matrix disassembly IMP >is this too downstream?

Annotation 25 Mouse miR-29b GO:0010628 positive regulation of gene expression IMP or IDA C16: has_ regulation_target Mmp2 and Mmp9 >is this too downstream?

Supplemental Figure 2D-F Mice transduced with anti-29b/pre-29b/Scr-miR. Col1a1 and Col3a1 are significantly upregulated with anti-29b, down-regulated with pre-29b in heart (D), liver (E), and kidney (F) samples of miR-29b modulated mice. Annotation 29 (also in context of whole paper) Mouse miR-29b GO:0035195 gene silencing by miRNA IMP C16: has_regulation_target Col1a1 [and Col3a1] occurs_in heart, liver, kidney. >Is it appropriate to annotate anti-29b data if miR-29b has not been shown to be present in these tissues? >Would the pre-29b data alone be annotated (as IDA) to these tissues if this was the only experimental data and no evidence that miR-29b is expressed in these cells? >Would the anti-29b data be annotated if this was the only data in the paper?

Annotation 33 (sorry order of annotations a bit out here) Mouse miR-29b GO:0060312 regulation of blood vessel remodeling IC WITH GO:1901202 negative regulation of extracellular matrix assembly, GO:0090091 positive regulation of extracellular matrix disassembly C16: abdominal aorta.

Annotation 34 (sorry order of annotations a bit out here) Mouse miR-29b NEW GO term: regulation of extracellular matrix remodeling IC WITH GO:1901202 negative regulation of extracellular matrix assembly, GO:0090091 positive regulation of extracellular matrix disassembly C16: abdominal aorta

Figure 6 Effects of anti-29b and pre-29b in AngII infusion model and miR-29b regulation in human patients with AAA.

Figure 6B-D (B) Col1a1, (C) Col3a1, and (D) Eln expression in scr-miR– and anti- and pre-29b–transduced mice compared with that in sham-operated mice in the AngII model.

Annotation 30 Mouse miR-29b GO:0035195 gene silencing by miRNA IMP C16: has_regulation_target Col1a1 [and Col3a1 and Eln]

Annotation 31 Mouse miR-29b GO:0032966 negative regulation of collagen biosynthetic process IC WITH GO:0035195 gene silencing by miRNA

Annotation 32 Mouse miR-29b GO:1901202 negative regulation of extracellular matrix assembly IC WITH GO:0035195 gene silencing by miRNA

Figure 6E-F (E) miR-29b is the only significantly downregulated miR in human AAA samples, compared with tissue from control patients without AAA. (F) COL1A1, COL3A1, COL5A1, and ELN are significantly upregulated in human AAA tissue compared with non-aneurysmal aortic tissue. >not annotated

Additional notes:

Mouse alignment identifies the sequences are on opposite strands: Query 3 AACACTGATTTCAAATGGTGCTAGA--CAATCACTATTTAAATCTAAACCACCATATGAA 60

          |||||||||||||||||||||||||  |||  | |    |||||||| ||||||| |||| 

Sbjct 74 AACACTGATTTCAAATGGTGCTAGATACAAAGA-TGGAAAAATCTAAGCCACCATGTGAA 16 Query 61 ACCAGCTTCC 70 |||||||||| Sbjct 15 ACCAGCTTCC 6

Mouse mir29b-1>dna/mouse_build_38_nib/chr6.nib:31063022-31063093 agaacactgatttcaaatggtgctagacaatcactatttaaatctaaacc accatatgaaaccagcttcct Mouse mir29b-2>dna/mouse_build_38_nib/chr1.nib:195037039-195037120 cttctggaagctggtttcacatggtggcttagatttttccatctttgtat ctagcaccatttgaaatcagtgttttaggag >hsa-mir-29b-1 MI0000105 CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG >hsa-mir-29b-2 MI0000107 CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG

The precursor miR-29b sequence was GGTACCGTTGTCTTGGGTTTATTG. The custom-made LNA-anti-miR-29b 5′-3′ sequence was ACTGATTTCAAATGGTGCT and alignment is shown below in red, it aligns with both human sequences.

>hsa-mir-29b-1 MI0000105 CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG >hsa-mir-29b-2 MI0000107 CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG

>Would you expect both miRs to be annotated based on the anti-29b experiments and would this be IGI evidence code?

When associating 'GO:0035195 gene silencing by miRNA' with a miRNA, based on an experiment using an anti-miR to demonstrate up-regulation of specific mRNA levels in the absence of the miR, how do we decide whether or not an mRNA is a direct target of a miRNA? Eg should we take into account: predicted targets, known targets (as stated by author) or only do this if there is base-pairing to mRNA demonstrated in the paper, and/or another paper?